Zo analyseer je een tulp in vier dagen

Genetica

Met de nieuwe nanopore- techniek is ook het genoom van plant- en diersoorten met ‘lastig’ en extreem veel DNA snel in kaart te brengen.

De oranje tulpenvariëteit Orange Sherpa. Foto Future Genomics Technologies

Waarom de tulpencellen zo uitzonderlijk veel DNA mee torsen, weet moleculair bioloog Hans Jansen niet. Misschien omdat de wilde tulp in de Turkse bergen moest overleven met extreem korte, hete zomers en lange winters, oppert hij. „De tulp moest uitzonderlijk snel groeien en tot bloei komen. Maar of dát de reden is dat hij zoveel DNA heeft? Dat kunnen we nu gaan onderzoeken.”

Hans Jansen is technisch directeur bij Future Genomics Technologies, een start-up die vorig jaar is opgericht door de Universiteit Leiden en laboratorium Baseclear. Future Genomics heeft het hele DNA van een oranje tulp (variëteit Orange Sherpa) in volgorde gezet. Dat is een mijlpaal. De tulp heeft namelijk een bizarre hoeveelheid DNA bestaande uit 35 miljard basenparen. Dat is ruim 11 keer zoveel als de mens, 280 keer meer dan de onooglijke zandraket en 47 keer meer dan de appelboom.

Uitzonderlijk veel herhalingen

Met de gangbare sequencing-apparaten, zoals die van het Amerikaanse Illumina, was het geen doen om de tulp te sequencen. Het omvangrijke tulpen-DNA bevat namelijk ook nog eens uitzonderlijk veel herhalingen. Soms wel duizenden, ongeveer dezelfde reeksen achter elkaar. Met de gangbare technologie moet het DNA eerst opgeknipt worden in vele kleine stukken en dan vermeerderd worden, voordat de basenvolgorde kan worden bepaald. Zelfs de beste rekensoftware kan zoveel opgehelderde tulpenstukjes, met zoveel herhalingen erin, niet meer in de juiste volgorde zetten.

Future Genomics lukte het nu wel dankzij een nieuw apparaat, een zogeheten nanopore-sequencer: de PromethION van het Britse Oxford Nanopore Sequencing. Met de nanopore-technologie zijn lange, aaneengesloten stukken DNA te sequencen, tot inmiddels meer dan 2 miljoen basen lang. In die lange stukken blijven de herhalingen gewoon op hun plaats. ATTCGGATTCCGGGGATTCCGGATTCATTCCGGGGAATTTTTTAATTTTTAATTTTT….. eindeloos veel letters, om precies te zijn 3.000 miljard, stuurt het apparaat in 24 uur tijd richting harde schijven. Die letters, A, T, C en G, staan voor de vier verschillende basen waaruit DNA bestaat. Wie de basenvolgorde weet, kan eigenschappen van een soort zoals kleur of ziekteresistentie beter voorspellen en veranderen.

In het kleine kamertje waar de PromethION op een bureautafel staat, laat Jansen zien hoe hij werkt. Het apparaat ziet er behoorlijk saai uit: grijs, clean, een soort kruising tussen een computer en een printer. Maar schijn bedriegt: sneller dan ooit tevoren is hiermee het DNA van mensen, dieren, planten en micro-organismen op te helderen.

Er zitten 48 plastic blokjes in waarin DNA kan worden ingespoten. In elk blokje wordt van duizenden strengen tegelijk de basenvolgorde bepaald. Die strengen lopen met zo’n 450 basen per seconde door een eiwitholletje (een ‘nanopore’), waarbij een elektrisch veld detecteert welke base zich door het holletje beweegt.

De server onder het apparaat vertaalt de gemeten stroomsterktes naar basevolgordes, waarna rekensoftware (grotendeels ontwikkeld door de Universiteit Leiden) de opgehelderde strengen weer aan elkaar plakt tot een heel genoom (al het DNA).

„Met PromethION kunnen we in zestig uur honderd keer de oranje tulp hebben gesequencet”, zegt Jansen. „Of bijvoorbeeld tien verschillende tulpenrassen, vijf keer de paling en drie keer de mens.” Al die basen moeten niet allemaal bewaard worden, zegt Jansen. „Dan staat deze kamer zo vol harde schijven. We moeten dus gaan kiezen wat we bewaren.”

De eindeloze herhalingen in het DNA van de tulp zijn bijvoorbeeld minder interessant. De tulp heeft er zoveel , omdat er extreem veel transposons in actief zijn, kleine ‘springende’ DNA-stukjes die regelmatig zichzelf vermeerderen waarna het kopietje zich elders in het DNA vestigt. Voor de financier van het project, tulpenkweker Dümen Orange, zijn die curieuze transposons niet belangrijk. Die wil vooral weten waar genen liggen om tulpenbollen minder vatbaar voor ziektes te maken. Als dat bekend is, kan hij sneller resistentere bollen ontwikkelen. Dat kan door reeds bekende genen in te kruisen, of met genetische modificatie.

Realtime meekijken

Het berekenen van het tulpengenoom uit de ruwe informatie van zes keer sequencen duurt nu nog zo’n vier dagen. Maar het apparaat en de software zullen snel verbeteren, verwacht Jansen: „De volgende stap is dat we real time mee kunnen kijken wat de DNA-volgorde is.”

Dan komen er heel nieuwe toepassingen in beeld. Bijvoorbeeld bij de snelle diagnose van ziekteverwekkers bij ernstig zieke patiënten, denkt Jansen: „Nu staan er behalve bij ons, PromethIONs bij Keygene in Wageningen en bij het Academisch Ziekenhuis in Utrecht. Maar ik voorspel: straks wil elk ziekenhuis er eentje.”

    • Marianne Heselmans